16024-576
16189C 16193.1C 16356C 16362C 16519C 234R 263G 315.1C 523del 524del 573.1C 573.2C
String
Alignment
Method
16024-576
TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCCCCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCCTCTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATRATAATAACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGTATGCACTTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAATACAACCCCCGCCCATCCTACCCAGCACACACAC‑‑CGCTGCTAACCCCATACCCCGAACCAACCAAACCCCAAAGACACCCCCCCCACA

EMPOP holds high quality population data

The EMPOP database aims at the collection, quality control and searchable presentation of mtDNA haplotypes from all over the world.

The scientific concept and the quality control measures using logical and phylogenetic tools were found suitable for forensic purposes, e.g.

  • by declaration of the German Supreme Court of Justice (2010)
  • the SWGDAM mtDNA interpretation guidelines (2013)
  • and the updated ISFG guidelines for mtDNA analysis (2014)

Alignment-free query engine for unbiased search results

EMPOP uses SAM, a string-based search algorithm that converts query and database sequences into alignment-free nucleotide strings and thus guarantees that a haplotype is found in a database query regardless of its alignment.

EMPOP3 uses an updated version (SAM-E) that considers block indels as phylogenetic events.

EMPOP generates conservative haplogroup estimates

EMPOP provides automated haplogroup estimates. These are based on maximum likelihood and minimal costs functions. For multiple possible haplogroups most recent common ancestor (MRCA) haplogroups are provided.

The geographical haplogroup patterns are provided via maps to visualize and better understand their distribution.

Education - EMPOP conferences and courses

The EMPOP project and database arose from collaborative studies that were established and discussed at scientific meetings. We continue this tradition to inspire and facilitate research.